Indonesia Conference Directory

Corresponding Author
Yusuf Subagyo

Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman
*yssp2015[at]gmail.com

Abstract
The purpose of this study was to measure the adaptability and productivity of local dairy cows in Banyumas district. About 30 lactation dairy cows from two groups of dairy farmers in the Baturraden and Sumbang sub-districts of Banyumas district were used in this study. To find out the adaptability is done by measuring the rectal temperature and the frequency of respiration at 06.00 am, 10.00 am and 14.00 am. Milk productivity was measured by measuring milk every day. Measurement of all parameters was carried out for one month. The results showed that there were no significant differences (P> 0.5) between the two sub- districts for all variables, namely: rectal temperature, respiratory frequency, HTC Benezra and Rhoad, and daily milk production. It can be concluded that the adaptability of local Holstein – Frisien dairy cows in Banyumas district is good, while milk production is moderate.

Keywords
Rectal temperature; Respiratory frequency; HTC; Milk production

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/rAJgetdqaRWx

Corresponding Author
LISA PRAHARANI

Institutions
*)RESEARCH INSTITUTE FOR ANIMAL PRODUCTION
JL. Banjarwaru, Ciawi, Bogor, PO BOX 221, 16002
**)Livestock EMBRYO CENTRE
JL. Cipelang, Bogor

Abstract
The Belgian Blue (BB) is a breed of cattle characterized by double muscling. Introduction of Belgian Blue cattle to Indonesian is to increase beef production. The aim of this study was to compare birth weight and morphometric traits of purebred BB calves to F1 BB x Friesian Holstein (FH) calves. A total of 10 purebred BB calves and 20 F-1 BB x FH calves were used in this study. Results showed that birth weight and chest girth were significantly affected by genetic and sex of calves (P<0,05). The purebreds had higher birth weight and chest girth (P<0,05). The birth weight were 54,82 kg and 42,86 kg for purebreds and crossbreds, respectively. The body height were 75,30 cm and 76,35 cm for purebreds and crossbreds, respectively. The body length were 66,96 cm and 66,33 cm for purebreds and crossbreds, respectively. The chest girth were 88,46 cm and 81,15 cm for purebreds and crossbreds, respectively. This study is a preliminary information used for developing BB cattle.

Keywords
Belgian Blue cattle, crossbreeding, birth weight, morphometric traits

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/4ZPRhMweuyVg

Corresponding Author
MOCHAMAD SOCHEH

Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman

Abstract
Abstract. The aim of the research is to investigate the effect of four different energy level in the ration into the calpain activity of Jawarandu does. The research was done during 5 months in the Experimental Farm of the Faculty of Animal Science, Universitas Jenderal Soedirman. The research material used was 16 heads of the Jawarandu doe with the aged 2.5−3 years. All the animals were randomly assigned to the ration treatment which forms four the different energy levels (82.26% TDN, 85, 87.93, dan 90.74% TDN). The replication of each treatment was four times. Variable measured was a calpain activity on the muscle of Longissimus dorsi. General linear model (GLM) of the SPSS was used to analysis variable measured. Energy content 1.63McalME/heads/day and 1.92McalME/heads/day as well as 1.73McalME/heads /day and 2.06McalME/heads/day were increased of the μ-calpain and m-calpain activities at the Longissimus dorsi muscle, respectively. However, there was decreased of the calpastatin activity at the Longissimus dorsi muscle. Different energy content of the ration increased the μ-calpain and m-calpain activities at the Longissimus dorsi muscle and of those decreased calpastatin activity.

Keywords
Calpain activity, Calpastatin activity, Energy level, Jawa Randu Does, Longissimus dorsi

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/ApB4yTF9YfmX

Corresponding Author
Imbang Haryoko

Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman Purwokerto

Abstract
The aim of the research is to investigate the effect of four different energy level in the ration into the calpain activity of Jawarandu does. The research was done during 5 months in the Experimental Farm of the Faculty of Animal Science, Universitas Jenderal Soedirman. The research material used was 16 heads of the Jawarandu doe with the aged 2.5−3 years. All the animals were randomly assigned to the ration treatment which forms four the different energy levels (82.26% TDN, 85, 87.93, dan 90.74% TDN). The replication of each treatment was four times. Variable measured was a calpain activity on the muscle of Longissimus dorsi. General linear model (GLM) of the SPSS was used to analysis variable measured. Energy content 1.63McalME/heads/day and 1.92McalME/heads/day as well as 1.73McalME/heads /day and 2.06McalME/heads/day were increased of the μ-calpain and m-calpain activities at the Longissimus dorsi muscle, respectively. However, there was decreased of the calpastatin activity at the Longissimus dorsi muscle. Different energy content of the ration increased the μ-calpain and m-calpain activities at the Longissimus dorsi muscle and of those decreased calpastatin activity.

Keywords
Calpain activity, Calpastatin activity, Energy level, Jawarandu Does, Longissimus dorsi

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/nJDg2PjcCmbQ

Corresponding Author
Ismoyowati Ismoyowati

Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman, Purwokerto, Indonesia

Abstract
The aim of this study was to determine differences in growth, carcass production and identify polymorphisms of adipocyte fatty acid binding protein (A-FABP) gene in Muscovy ducks from the second generation selection (G2). The research material used 180-day-old Muscovy ducks consisting of male and female ducks with white feathers and male and female ducks with a combination of black and white feathers. Measurement of duck body weight was carried out every week, and ducks are slaughtered at 10 weeks to obtain carcass production data. The data obtained were analyzed by systat-13 program based on variance analysis and Duncan test. The primary design was based on a database of the genebank Cairina moschata adipocyte fatty acid binding protein (A-FABP) gene, exons 1, 2 and partial cds (FJ763338.1). The primary base sequence of the A-FABP gene was the primary forward: 5- TCTGGGGGTGTTATCTGGAG -3 and reverse primer: 5- ATTTGTCAGTGGCTGTGCTG -3. The sequencing results of PCR products were analyzed using bioedit version 7.7 to determine the presence of the A-FABP gene polymorphism. The results showed that at the same age male Muscovy ducks produced carcass weight, and thickness of breast meat higher than female ducks. Body weight, carcass weight and parts of the carcass (breast, thigh, back, and wings) of a combination black-white feather male ducks higher than the male white feathers. The abdominal fat on all the ducks relatively the same. The A-FABP gene PCR product was at 176 bp. The results of bioedit analysis showed that at 151 bp, base length there was a mutation from Guanin to Adenin in the observed Cairina moschata, both male and female Muscovy ducks with white feathers and black-white combinations. All ducks observed had homozygous AA genotypes. Base changes in SNP c. 151G> A indicate a transition mutation. The study concluded that male Muscovy duck with a combination black- white feathers have highest genetic potential in body weight and carcass production with thick meat breast compared to other ducks. The weight of abdominal fat was relatively the same in male and female manila ducks. The A-FABP gene in manila ducks was monomorphic.

Keywords
Carcass percentage, Monomorphic, Muscovy duck, thick meat breast

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/cNy94qVtBY6k

Corresponding Author
MOCHAMAD SOCHEH

Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman, Karangwangkal Kampus, Purwokerto 53123, Jawa Tengah - Indonesia
*Correnpondence E-mail: msocheh1956[at]gmail.com

Abstract
The aim of this study was to study the effect of giving different levels of energy feed on the concentrations of estrogen and progesterone during estrus and on the 14th day after mating on thin-tail ewes. The material used in this study was 15 head of thin-tail ewes aged between 2.50-3.00 years had a normal estrus cycle and had once lambing. All ewes were randomly placed into three types of treatment of energy feed with different levels, namely: non-flushing 1.01Mcal / kg ME (f0), flushing 2.13Mcal / kg ME (f1) and flushing 2,31Mcal / kg ME (f2). Each treatment was repeated 5 times. The general linear model of SPSS was used to analyze variables measured. The results showed that the average estrogen concentration in thin-tailed ewes during estrus in the flushing group (f1 and f2) was higher than non- flushing (f0). The average progesterone concentration in the thin-tailed ewes on the 14th day after mating in the flushing group (f1 and f2) was higher respectively than the non-flushing group (f0). The increase in feed energy given to thin-tailed ewes in flushing, during estrus increases estrogen concentration and on the 14th day after mating, increase progesterone concentration.

Keywords
Keywords: thin-tailed ewes, feed energy, estrus, 14 days after mating,

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/WbKYPt8N2nVp

Corresponding Author
Suyadi Suyadi

Institutions
1Laboraotory of Animal Reproduction and Breeding
2Laboratory of Dairy Production
Faculty of Animal Science, Universitas Brawijaya. Jl. Veteran, Malang 65145, Indonesia

Abstract
The aim of this study was to evaluate the conception rate of 11-months old dairy heifer following artificial insemination with natural estrus or treated with PGF2α at PT. Ultra Peternakan Bandung Selatan. A case study was applied in this study involving all data of 700 records for date of birth, body weight and reproduction status. Sample was selected according the complete records with criteria of age was 11±3 months, body weight >300kg, having normal reproduction organs detected by rectal palpation. The results showed that from selected 300 samples out of 700 heifers, were observed of 25 heifers were natural estrus (Control), 50 estrus after single PGF2α injection (PG), 95 following single PGF2α and left to normal estrus after 21 days (PG-N), 50 after double PGF2α (2PG), and the rest of 80 heifers showed estrus following double PGF2α – Natural estrus (2PG-N) with the conception rate (CR) of 17/25(68%), 44/50(88%), 42/50(84%), for the respective groups. None of heifers in PG-N and 2PG-N groups became pregnant after first insemination. The body weight (BW) was classified into Low (336-347kg), Medium (348-359kg) and High (360-372kg). The total conception rate was 34%. The CR for Low, Medium and High BW were 41%, 32% and 31%, respectively. The conclusion, the 11-months old heifer was possible normal pregnant following insemination without and with PGF2α injection when reached body weight over 300 kg. To ensure the higher number animal exhibiting estrus, double PGF2α injections should be applied.

Keywords
11-months old heifers, natural estrus, PGF2α induced estrus, conception rate.

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/zMDRmeZxLfTn

Corresponding Author
Tri Eko Susilorini

Institutions
Faculty of Animal Science, University of Brawijaya.
Jl. Veteran, Malang 65145, Indonesia

* Email: triekos[at]ub.ac.id
pratiwiwulan97[at]gmail.com
suyadi2008[at]yahoo.com

Abstract
This study was to evaluate the conception rate of yearling dairy heifer at PT. Ultra Peternakan Bandung Regency following artificial insemination with PGF2α-induced estrus. A total of 100 heifer records selected randomly from 700 heifers based on body weight (>300 kg) and has normal reproduction were used for this study. Non estrus animal during one day observation was then injected with PGF2α for estrus induction. The animal showing estrus within 11 days observation post PGF2α injection, was inseminated, nevertheless was reinjected for second PGF2α, and the estrus animal was inseminated according to the standard procedure. The results showed that following first PGF2α injection, 50 heifers showed estrus, while 50 non-estrus others were re-injected PGF2α. All 50 animals showed estrus following second PGF2α injection within 11 days thereafter. Body weight was divided into 3 groups, Low (<341 kg), Medium (341-355 kg), and High (>355 kg). There were significant difference (P<0.05) for Service per Conception, S/C (1.94±0.86, 1.60±0.74 and 1.78±0.87), and Conception Rate, CR (39%, 54% and 50%), respectively for Low, Medium and High body weight of yearling heifer. It was concluded that yearling dairy heifers were possible to breed and result pregnancy when reached body weight more than 300 kg.

Keywords
dairy industry, yearling heifer, estrus induction, conception rate.

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/jkHMeZ4ntfBC

Corresponding Author
Ismoyowati Ismoyowati

Institutions
Universitas Jenderal Soedirman

Abstract
Poultry meat and eggs are one of the most widely consumed livestock food in various parts of the world, across a wide variety of cultures, traditions and religions. In 2016 the duck population (Anas spp.) throughout the world reached 1.24 billion and 1.1 billion (89 percent) were in Asia. The production of meat and duck eggs is still under chickens, but ducks make a significant contribution in providing high-quality nutritional food needs. The consumption of duck eggs accounts for around 10-30% of total egg consumption in China and Southeast Asia. Duck eggs contain all essential amino acids required by the human diet and are a good source of vitamins and minerals. Due to lower water content, they are more nutrient than chicken eggs. Asian is the leading continent in duck meat production with a share of 82.2%, followed by Europe with 12.4%. Asia has also the highest increase of total and of per capita duck meat by 308% and 244%, respectively. Almost 10 percent of poultry meat in Asia is compared to 4.1% in the world. People consume the duck meat because of their high nutritional value with complete essential amino acid composition and good fatty acid composition with a high percentage of polyunsaturated fatty acids and a balanced ratio between omega-6 fatty acids and omega-3. Large-scale duck production requires more efforts for higher efficiency and improving product quality by breeding, nutrition and management in accordance with animal welfare requirements and environmental protection. Family duck farmers (small-scale production) with limited capital contribute significantly to food security, poverty alleviation and the ecologically sound management of natural resources. Farmers must have more access to obtain good duck breed, appropriate technology and service support, which can substantially increase productivity, income and food security.

Keywords
Duck, meat, egg, food security

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/MQ8XawKreBNm

Corresponding Author
Elly Tugiyanti

Institutions
Faculty of Animal Science, University of Jenderal Soedirman, Purwokerto 53123

Abstract
The aim of this research was to understand the effect of liquid probiotic supplementation in drink water on blood cholesterol ( HDL, LDL,Triglyceride) level, hemaglobin level (Hb), plasma hematocrit level and total of plasma protein (TPP) of quails. Prohibition of antibiotics in poultry, resulting in increased probiotic offers on the market. Each probiotic has an advantage in increasing productivity and immunity of quails. The research was conducted as an experimental research and used completely randomized design. Four treatments were done in this research, which was control (drink water without probiotic), drink water added by probiotics A (containing Lactobacillus sp., Rhodopseudomonas sp., Streptococcus sp., Saccarhomyches sp.), probiotic B (containing Bacillus careus, Azotobacter paspalii, Bacillus laterosporu, Bacillus lentus, Bacillus licheniformes, Bacillus pumilus Corynebacterium, Pseudomonas fluorescens Sarcina lutea Staphylococcus epidermis Staphylococcus thermophyllus Lactobacillus sp. Saccharomyces cerevisceae and Phicia anomola) and probiotic C (containing Lactobacillus casei, Saccharomyces cerevisceae, Rhodopseudomonas palustris, Molases, water). The obtained all data were then analyzed by analysis of variance and if the result showed a significant effect, further analysis will be done by honestly significant difference test. The analysis of variance showed that variety of fluid probiotic supplementation in drink water showed had no significant effect (P>0.05) on the on blood cholesterol, HDL level, LDL level, triglyceride, but had significant effect (P<0.05) on Hb, plasma hematocrit and TPP level. The research concluded that liquid probiotics supplementation in drink water will increase immune response but not able to reduce blood cholesterol of quails.

Keywords
Antibiotics, Probiotics, Drink water, Cholesterol, Quails.

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/XLP9CRF3tjex

Corresponding Author
Luqman Hakim

Institutions
(1) Fakultas Peternakan Universitas Bawijaya
(2) Fakultas Peternakan Universitas Jenderal Soedirman

Abstract
Abstract. Nutritional status (protein and energy) during early life has important effect on milk yield of dairy cows. Feed quantity and quality is often influenced by season representing the fluctuation of water supply which is essential for plants including forage. The aim of the present study was to analyse the effect of year and season of birth on first-lactation milk yield of Holstein Friesian cows. The data included 1005 records of first-lactation daily recorded milk yield available in National Breeding Centre for Dairy Cows and Forages of Baturraden (the so-called BBPTUHPT Baturraden) database. The milk yield was recorded within the years of 2004 to 2014. Milk yield data were adjusted to 305 standard days of milking using multiplicative-local correction factor. Animals- date of birth was grouped divided into years and months of birth. Months of birth were assigned into: (1) traditional-two season categorization (wet and dry), (2) extended-categorization of three seasons (wet, wet-dry and dry), (3) extended-categorization of four seasons (wet, wet-dry, dry and dry-wet). The effect of date of birth factor on first-lactation milk yield was tested using likelihood ratio test of full and reduced model. The result showed that both years and months of birth have significant effect on first-lactation milk yield, regardless of the season categorization. It is therefore concluded that season plays important role to consider in dairy cattle management and has to be included in genetic analysis to remove non-genetic effect which regards to first-lactation milk yield.

Keywords
birth, cows, non-genetic, Holstein, Indonesia

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/krgYU3Cf96MN

Corresponding Author
Agus Susanto

Institutions
1) Graduate Program, Faculty of Animal Science, Brawijaya University (UB), Malang, Indonesia
2) Faculty of Animal Science, Brawijaya University (UB), Malang, Indonesia
3) Faculty of Animal Science, University of Jenderal Soedirman (UNSOED), Purwokerto, Indonesia

Abstract
Nutritional status (protein and energy) during early life has important effect on milk yield of dairy cows. Feed quantity and quality is often influenced by season representing the fluctuation of water supply which is essential for plants including forage. The aim of the present study was to analyse the effect of year and season of birth on first-lactation milk yield of Holstein Friesian cows. The data included 1005 records of first-lactation daily recorded milk yield available in National Breeding Centre for Dairy Cows and Forages of Baturraden (the so-called BBPTUHPT Baturraden) database. The milk yield was recorded within the years of 2004 to 2014. Milk yield data were adjusted to 305 standard days of milking using multiplicative-local correction factor. Animals- date of birth was grouped divided into years and months of birth. Months of birth were assigned into: (1) traditional-two season categorization (wet and dry), (2) extended-categorization of three seasons (wet, wet-dry and dry), (3) extended-categorization of four seasons (wet, wet-dry, dry and dry-wet). The effect of date of birth factor on first-lactation milk yield was tested using likelihood ratio test of full and reduced model. The result showed that both years and months of birth have significant effect on first-lactation milk yield, regardless of the season categorization. It is therefore concluded that season plays important role to consider in dairy cattle management and has to be included in genetic analysis to remove non-genetic effect which regards to first-lactation milk yield.

Keywords
birth, cows, non-genetic, Holstein, Indonesia

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/cMtuAzWC2qe8

Corresponding Author
widodo suwito

Institutions
1) Assessment Institutes for Agricultural Technology of Yogyakarta
JL. Stadion Baru Maguwoharjo No. 22, Karang Sari, Wedomartani, Ngemplak, Sleman, Yogyakarta (0274) 884662.
* Corresponding author email: widodo.suwito[at]yahoo.com

2) Faculty of Veterinary Medicine, Gadjah Mada University, JL. Fauna No. 2, Bulaksumur Yogyakarta 55281

3) Research Institute Veterinary Science
Jl. R.E. Martadinata No.30 Kotak Pos 151, Bogor, Indonesia, 16124

Abstract
Subclinical mastitis in Ettawa crossbreeds (PE) is an inflammatory disease that no clinical symptoms, but there is an increase the number of somatic cells and causes decrease milk production which economically detrimental. The aim of this study was to isolation of bacteria that causing subclinical mastitis in PE goats and their sensitivity with antimicrobial. A total of 37 PE goats from 5 farms in Kulonprogo were tested by California Mastitis Test (CMT). PE goats were said subclinical mastitis if the CMT test positive (++) or (++). Bacterial examination was carried out by enrichment in the peptone water buffer medium (BPW), and cultured in mannitol salt agar (MSA), eosin methylene blue agar (EMBA), and blood agar plate (PAD). Bacterial identification based on Gram staining, and biochemical tests such as confectionery. Subclinical mastitis in PE goats in Kulonprogo was caused by S. intermedius positive coagulase 4/4 (100%), S. aureus negative coagulase 4/10 (40%), S. aureus positive coagulase 3/10 (30%), and E. coli 1/10 (10%). S. intermedius positive coagulase was resistant to ampicillin, tetracycline, and sulfamethoxazole 2/4 (50%) respectively. S. aureus positive coagulase was resistant to ampicillin 2/7 (28.6%), penicillin 1/7 (14.3%), and sulfamethoxazole 1/7 (14.3%). S. aureus negative coagulase was resistant to ampicillin 3/7 (42.9%), penicillin 3/7 (42.9%), sulfametoxazole 2/7 (28.6%), and tetracycline group 1/7 (14.3%). This study showed that subclinical mastitis PE goats in Kulonprogo were caused by S. intermedius positive coagulase and S. aureus negative coagulase which are resistant to penicillin and sulfamethoxazole.

Keywords
Isolation, subclinical mastitis, PE goat, antimicrobial

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/NGFu8trEHvck

Corresponding Author
Dattadewi Purwantini

Institutions
1) Faculty of Animal Science, University of Jenderal Soedirman, Jl. Dr. Soeparno No. 60, Purwokerto 53122, Central of Java, Indonesia
2) Faculty of Agriculture, University of Tidar, Jl. Kapten Suparman No. 39, Magelang 56116, Central of Java, Indonesia

Abstract
The aim of this research is to estimate the heterosis value of Magelang and Tegal crossed ducks morphometrics characteristics. The cross between the Magelang duck male and the Tegal female is called Maggal (F1). The research material are 319 ducks consisted of Magelang and Tegal ducks with 10 males and 70 females each, also the cross result of 239 Maggal ducks. Research method is experiment. The variable measured was the morphometric characteristics (body weight, body length, chest circumference, abdominal circumference, shank length, pubis length, and neck lenght) of the duck aged at 6 months. The heterosis value is obtained by comparing the ability of the cross with the parent. This research has shown heterosis in body weight, body length, chest circumference, abdominal circumference, shank length, pubis length, and neck lenght of 6 month old Gallang and Maggal duck were 0,03; 0,01; 0,06; 0,02; -0,05; 0,01; dan 0,03. Based on the results of this study, it can be concluded that the heterosis value of Magelang and Tegal crossed ducks morphometrics characteristics were relatively high. The positive heterosis value in body weight, body length, chest circumference, abdominal circumference, pubis length, and neck lenght, while shank length negative.

Keywords
heterosis, morphometrics, crossed duck, Tegal ducks, Magelang ducks

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/QbEU7q2dLPDV

Corresponding Author
Anis Sri Andini

Institutions
a) Postgraduate Master Program of Animal Husbandry, University of Jenderal Soedirman
* anissriandini997[at]gmail.com
b) Faculty of Animal Husbandry, University of Jenderal Soedirman
Jl. Dr. Soeparno, No.60, Purwokerto Utara, Indonesia.

Abstract
This study aims to identify the quantitative characteristics of local chickens and examine the presence of polymorphisms based on the nucleotide sequences of ACTA-1 genes. The material used is a local chicken consisting of 25 Pelung and 25 Native chickens. The quantitative data uses t test. Identification ACTA-1 gene polymorphism is carried out by PCR method and Sequencing of PCR product. The quantitative characters, of male Pelung and Native chickens significantly different, involving the length of tarsometatarsus, tarsometatarsus circumference, comb height and body weight. Meanwhile, female Pelung and Native chickens show significant differences in femur length, tibia length, tarsometatarsus length, tarsometatarsus circumference, third finger length, wing length, comb height and body weight. The sequencing result indicates the presence of SNPs (Single Nucleotide Polymorphism) among them c.584 T > G, c.585 T> A, and c.657 T> C. Furthermore, in the base c.657 T> C the heterozygosity value of 0.18. Based on correlation value at c. 585 T>A shows that AA genotype has a significant effect on body weight (P<0,05). Therefore, the ACTA-1 gene is an important marker, which can be used to improve the economic characteristics found in local chickens.

Keywords
Chicken, qualitative traits, quantitative traits, ACTA-1 gene, frequency genotypic, heterozygosity

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/b2hTfDgWKBMR

Corresponding Author
Sigit Prastowo

Institutions
1) Animal Science Department, Faculty of Agriculture, Universitas Sebelas Maret. Surakarta – Indonesia
*prastowo[at]staff.uns.ac.id
2) Artificial Insemination Center Singosari, Singosari, Malang, Indonesia

Abstract
Semen quality is an important factor influencing the success of a cattle breeding program. Efforts to continuously evaluate the semen quality parameter is needed. Indonesia has Bali cattle; it is indigenous, tropically adapted, robust, and has high fertility. Bali cattle need to be developed into meat producer by selecting the best bulls and disseminate their sperm through artificial insemination program. To obtain the desired improvement, one of the key is to ensure the semen quality. This study aimed to determine the factors affecting fresh semen quality of Bali bull. In total, 864 ejaculates were collected from nine bulls from January to October 2016. Semen was collected twice a week, followed with semen quality evaluation as semen volume (ml), sperm concentration (x106/ml), sperm motility (%), and pH. A linear model was built to obtain the significant fixed factor of season and/or age affecting sperm quality followed by mixed model procedure including individual bulls as random effect to estimate the variance components. The result showed that season didn-t give any effect (p>0.05) in all fresh semen quality observed, while there was a significant effect of age (p<0.05) on volume, sperm concentration and pH. There is no interaction (p>0.05) between season and age in this study. The variance component of individual bulls contributed 71.15, 67.92, 48.22, and 11.76% of the total variance of semen volume, sperm concentration, sperm motility, and pH respectively. This study shows that there is a wide variation of semen quality resulted due to the variation between individual of the Bali cattle bull, which mirroring the diverse of Bali cattle genetic. In bulls selection as semen source, careful selection and the application of genetic standard need to be concerned.

Keywords
semen quality, Bali cattle bull, individual variance component

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/udJce3CvnNrH

Corresponding Author
Laurentius Rumokoy

Institutions
a) Entomology Program, Postgraduate School, Sam Ratulangi University, Jl. Kampus Unsrat. Manado 95115, Indonesia
b) Animal Science Program, Faculty of Animal Husbandry, Sam Ratulangi University, Jl. Kampus Unsrat. Manado 95115, Indonesia
*wisje_toar[at]live.com

Abstract
This experiment aimed to study the effect of serum G-antigen on M. domestica insect larvae (LAS) as promoter antigen on serum immunoglobulin production in organically managed goat livestock. This study used 12 local goat animals which were divided into two groups, a control group and a group receiving treatment. Insect rearing was used to obtain larvae, the antigen-G was then extracted from the larvae to be used as promoter antigen to enhance the serum antibody production which was subcutaneously immunized in experimental goats and incubated for a period of 14 days. Blood collection of 2.5 ml was taken through the jugular vein and then quantification of the total antibody is carried out. The data of the LSA extract proportion level were statistically analyzed with t-test, and the quality classification level of serum immunoglobulin of animals groups were statistically analysed. The results showed that the serum of animal treated with LSA of M. domestica resulted in a higher level of immunoglobulin (P <0.01) compared to the control. We conclude that the antigen-g substance (LSA) could support the efforts to improve the production of organic goats livestock by increasing the total level of antibodies circulating in the blood.

Keywords
Insect, Musca domestica, antigen, antibody, goats

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/kq6p2RUvdtKL

Corresponding Author
Dicky Pamungkas

Institutions
Indonesian Beef Cattle Research Institute (IBCRI),
Indonesian Agency of Agriculture Research and Development (IAARD)
Jl. Pahlawan No 02. Grati, Pasuruan. INDONESIA

Abstract
Excellent performance of bull as sperm producer was needed to maintain and increase the high pregnancy cows. The study aimed to determine the effect of mineral-vitamin combining (MVC) and herbs supplementing (HS) on feed intake, feed efficiency, average daily gain (ADG), linear body, semen quality and B/C ratio of Ongole Crossbred bull. Eight animals (aged 3 to 5 years) within initial weight 505.2 ± 70.5 kg were examined. They were grouped in two feed regimes, firstly, the basal diet was given with the inclusion of Vitamin A, E and Zinc-minerals (P1) and secondly, were basal diet plus herbs supplementation (P2). The basal diet consisted of elephant grass, gliricidia, and commercial concentrates. Feeding was assigned to dry matter (DM) of 3% of body weight (BW) to meet the balance nutrient intake. The experimental which conducted as long as three months, was designed in two treatments and four replicates. Data analysed by using the T-test. There was no significant different between P1 and P2 in the results on feed intake, efficiency, ADG, and linear body. However, the sperm concentration of P1 (1,366.7 ± 768.9 million/ml) was higher(P<0.05) than those of P2 (873,3 ± 488.7 million/ml). Meanwhile, the sperm viability of P1 (90.4 ± 8.5%) was also higher than that of P2 (78.7 ± 16.2%). Both P1 and P2 were recommended for being used commercially (due to requirement of Indonesia National Standard/SNI 4869-1:2017), but the P1 was the efficient one in regards of the B/C ratios.

Keywords
supplementation, Ongole crossbred, bull

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/9yXhPUr4nQLG

Corresponding Author
Luh Gde Sri Astiti

Institutions
Balai Pengkajian Teknologi Pertanian West Nusa Tenggara (a)
Faculty of Animal Husbandry Mataram University (b)

Abstract
The objective of this study was to determine haematology profile of Nematodiasis of Bali cattle in Lombok Island, West Nusa Tenggara. Recently, in this region the population of Bali cattle was increased. However, the cattle management adopted has still traditional and likely has high risk infected by gastrointestinal parasite such us nematode. The gastrointestinal parasites infection by nematodes can cause health problems and will impact on decline in production, economic losses, decreasing ability to extract nutrients from raw food, fertility, ability to eat, weight loss, decline on milk production, increased costs of treatment due to anaemia, oedema, diarrhoea, yellowish, depression and even death. Faecal from cattle that suspected invested by nematode take and nematode-s egg investigated with Wisconsin technique. Fifteen samples selected for a haematological profile study. The haematological profile shows high persentase of eosinophil on the blood. This indicates that the Bali cattle have developed its own mechanism to depend against parasite infection and allergic reaction.

Keywords
Bali Cattle, Haematology, Nematodiasis

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/8Te324XAJaZC

Corresponding Author
Sulastri Sulastri

Institutions
Animal Production Department, Faculty of Agricultural, Lampung University

Abstract
ABSTRACT Research by survey method was conducted to know population performance of Saburai goat at Saburai goat breeding area, Tanggamus regency, Lampung province based on natural increase (NI) and net replacement rate (NRR). Observation was done begin 2015 when Saburai was declared as local genetic resources in 2015 by Ministry of Agricultural. Population of Saburai goat in 2015, 2016, 2017, and 2018 were 1,469 heads, 2,369 heads, 2,860 heads, and 3,293 heads. Male and female Saburai goat were used as breeding stock for 4.44 ± 0.20 years and for 5.03 ± 0.21 years, respectively. Replacement stock needed in 2018 were highest (25.39 % for male and 27.91 % for female). Percentage of Saburai goat birth were 9.72 ± 6.57 % for male goat and 19.72 ± 5.18 % for female. Value of NI for male and female goat were 9.25 % and 19.13 %, respectively. Value of NRR in 2018 were highest (male 114.69 % and female 458.94 %). It could be concluded that population performance of Saburai goat from 2015 up to 2018 were increasing.

Keywords
Saburai goat, Breeding stock, Natural increase, Net replacement rate, Local genetic resources

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/aKqcA3JZzfd9

Corresponding Author
Franky M S Telupere

Institutions
1)Department of Animal Science, Faculty of Animal Husbandry, Nusa Cendana University, Address: Adisucipto Street Penfui Kupang East Nusa Tenggara Indonesia
e-mail correspondence: kupangph[at]yahoo.com, telp. +62 813-3760-2663
2) Department of Animal Science, Faculty of Animal Husbandry, Nusa Cendana University, Address: Adisucipto Street Penfui Kupang East Nusa Tenggara Indonesia
e-mail: nalleywm[at]yahoo.co.id telp. +62 812-9314-722

Abstract
Sabu and Semau chickens are originated from Sabu and Semau islands, East Nusa Tenggara. The aim of this study was to analyze the phenotypic and genetic of growth characteristics of Sabu and Semau chickens which were conserved ex-situ. Four mating groups as treatments and each using 4 males and 24 females, produced 144 chicks as research material. Mating was by artificial insemination. Observations include data on body weight from the age of 0 - 12 weeks. Nested design analysis were used to obtain the variance components used to estimate the heritability. Heritability was estimated based on male, female, and total variance. The results showed that the body weight resulting from the interse mating (SS) was better than other crosses. The estimation of heritability based on male variance (h2S), SS, MM, and SM showed positive values, while MS are more negative, except 8 weeks of age. Likewise based on females (h2D) and the total variance (h2S+D). Heritability estimates of body weight were low to hight (-2.31 to 2.33) due to small data or sample size. It can be concluded that Sabu and Semau chickens can be conserved ex-situ.

Keywords
Sabu and Semau Chickens, Phenotype, Genetic, Growth, Heritability

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/KTxv8WuRVDXH

Corresponding Author
nuzul widyas

Institutions
1Department of animal science, Universitas Sebelas Maret, Jl. Ir. Sutami 36A Kentingan Jebres Surakarta 57126, INDONESIA

2Bali Cattle Breeding Center (BPTU-HPT Denpasar), Jl. Gurita 3 Pegok Sesetan Denpasar 80223, INDONESIA

Abstract
This study aimed to estimate the phenotypic and genetic correlations of growth traits as selection criteria in Bali Cattle test center populations at Pulukan Breeding Center, Livestock and Forage Feeding Center (BPTU-HPT) Denpasar, Bali. In total 160 records were obtained from calves born between 2013 until 2016. Data collected were birth weight (BW), weaning weight (WW), yearling weight (YW), mature weight (MW) and pedigree. Data were then standardized to be weaning weight at 205 days (WW205), yearling weight at 365 days (YW365) and mature weight at 730 days (MW730). The data obtained were analyzed using univariate and bivariate animal models with REML method. Heritability values (h2) were 0.43 ± 0.12, 0.22 ± 0.12, 0.39 ± 0.15, 0.63 ± 0.18 for BW, WW205, YW365 and MW730 respectively. Phenotypic correlations among variables were vary from low to high; which were 0.16 for BW - WW205, 0.11 for BW - YW365, 0.34 for BW - MW730, 0.61 for WW205 - YW365, 0.25 for WW205 - MW730 and 0.31 for YW365 x MW730. However, the genetic correlation among growth traits were considerably high: BW - WW205 0.53, BW - YW365 0.76, BW - MW730 0.47, WW205 - YW365 0.70, WW205 - MW730 0.48, YW365 - MW730 0.64. Heritability of Bali Cattles- growth traits are categorized as moderate to high, thus selection on these traits are potential to obtain genetic improvement in the population. Phenotypic correlations among traits were considerably low, whereas the genetic correlations spanned between medium to high. These findings implied that other than genetic, improving the farm environment and management could also affect the growth performance of Bali cattle.

Keywords
Bali Cattle, growth traits, heritability, phenotypic correlation, genetic correlation

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/BVxCYmk6e3PJ

Corresponding Author
Sri Bandiati Komar Prajoga Bandiati Komar Parjoga

Institutions
Department of Animal Production, Faculty of Animal Husbandry, Padjadjaran University,Bandung Sumedang KM.21 street, Hegarmanah, Jatinangor, Sumedang district, West Java 45363

Abstract
Padjadjaran sheep was a local sheep that has undergone purebreeding in the form of linebred, has a variation of mt-DNA in the form of 75 bp deletions at the posision of 1447-1522 bp. Male birth weight was 3.5 - 4 kg, while adult body weight (18 months) was 35-45 kg. On the molecular genetic side Albumin was the guardian of the osmotic balance of blood, Albumin will encourage fluid if the condition low in the blood and pushes out if the liquid high in blood . Albumin was formed in the liver and binds absorbed nutrients to spread throughout the body. In high body fluids in sheep causes swelling in the whole body and there was a tendency to less optimal growth. Growth was an increase in body weight in a certain period of time, which was divided into stages of acceleration and deceleration. In elite rum selection programs carried out based on individual data, the ranking based on their position in the population. The research method was descriptive for quantitative charakter and data analysis using correlation, as well as the SDS-page method for blood protein analysis. The object of the study was 46 rams as candidate for elite rums, which had body weight between 27 - 45 kg, with an average body weight of 35.3 kg. The results showed that the blood protein Albumin of Padjadjaran sheep was spread in several alleles from Alb. A, Alb.B, Alb.C, Alb.D, Alb.E and Alb.F. All of population have (100%) have Albumin A which had highest Correlation (0,21) with body weight gain aged 17 to 18 months, while the other Alb alleles showed a low correlation

Keywords
Key words: Padjadjaran sheep, Blood Protein Albumin , Accelaration , Deceleration

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/Xg9mMfdYypPn

Corresponding Author
Ellin Harlia

Institutions
Faculty of Animal Husbandry, Universitas Padjadjaran

Abstract
The laying hens livestock industry is growing rapidly along with the increasing demand for eggs for human consumption, will produce large amounts of waste. Improper management of laying chicken farm waste can interfere with health and environmental pollution including greenhouse gases (CH4, CO2, N2O), odor disorders, disturbances from rodent animals, disturbances of endoparasites and ectoparasites, pollution of water and soil sources. Appropriate waste management can reduce the risk of pollution of the laying hens industry to the environment. Utilizing feces of laying hens as a microbial consortium sources that serves as a biogas starter in anaerobic digester as an alternative environmental friendly energy source is an option. The purpose of this study was to obtain a bacterial and methanogen consortium from laying hens feces as a starter of biogas with coal media in anaerobic digester. The study used an experimental method of completely randomized design (CRD) with 4 doses and 4 replicates with 5 observations, data than tested further using orthogonal polynomials. The stages of the study included three stages: first, pretreatmen using in vitro technique; second, the adaptation process; third, addition starter of microbial consortium from the laying feces of the chicken into liquid media and coal at a dose of 0%, 5%, 10% and 15% then incubated at 39oC for 28 day. Observations were conducted every 7 days from day 0, day 7, day 14, day 21 and day 28. The parameters measured were the volume of biogas, the number of anaerobic bacteria and the composition of biogas. This biogas composition was analyzed by Gas Chromatography, the number of anaerobic bacteria cultured in Hungate tubes and calculated using the Ogimoto method. The observations showed that the number of bacteria ranging from 1012 CFU/ml up to 1013 CFU / ml exceeded the starter requirements of 107 CFU/ml.

Keywords
Microbial, Feces, Laying Hens, Biogas, Starter

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/wqyjKDaALk6t

Corresponding Author
Jaswandi Jaswandi

Institutions
(a) Biotechnology Laboratory of Animal Husbandry Faculty of Andalas University
(b) Departemen Social Economy and Farm Extention of Animal Husbandry Faculty of Andalas University
(c) Animal Breeding Center

Abstract
Simmental cattle are superior cows from subtropics imported to Indonesia to improve genetic quality. The purpose of this study was to determine the performance of Simmental cows in tropical environments, especially Indonesia. This study used 35 Simmental cattle which had complete recording and were maintained at Animal Breeding Research Center in Padang Mengatas. Selected Simmental cows were 4-6 years old and have normal reproduction. The data observed included the age of first mating, the length of first pregnancy, the age of first calving, the service period and calving interval. Data are presented descriptively and expressed in term of mean and standard deviation. The results showed that the age of first mating, the length of first pregnancy, the age of first calving, the service period and calving interval were 526.8 ± 99.84, 280.68 ± 8.18, 825.48 ± 99.64, 182.82 ± 84.29, 279.88 ± 13.40 and 462.71 ± 97.69, respectively. The average birth weight of a calf is 31.39 ± 4.9 with the male and female ratio are 48.57: 51.42. It is concluded that the performance of Simmental cow is not optimal which can be seen from a length of calving interval

Keywords
reproductive, simmental cow, tropical environment

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/Ne846hRcqx2U

Corresponding Author
Dadang Mulyadi Saleh

Institutions
Faculty of Animal Science, Jenderal Soedirman University

Abstract
Sexually mature Indonesian native hens (Sentul hens) were housed singly in laying cages and artificially inseminated with combination of three different levels of diluted pooled semen (50 million sperm/0.05 ml; 100 million sperm/0.1 ml; and 150 million sperm/0.15 ml) and at either of three different intervals (every 3, 6 and 9 days). The results show that the sperm number and Insemination inverval had no significant interaction (P>0.05) on % fertility and hatchability. The best fertility (P< 0.05) was obtained by inseminating interval 6 days with sperm number 100 million/ 0.1 ml of diluted semen.

Keywords
Sperm number, insemination interval, fertility, hatchability, sentul hens

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/XbeDzfj8yw24

Corresponding Author
Arika Rizki Rofikoh

Institutions
(a) Postgraduate Master Program of Animal Science, Jenderal Soedirman University
(b) Faculty of Animal Science, Jenderal Soedirman University

Abstract
This research was aimed to determine the potential breeding worth of cows at different age based on body weight (BW), chest circumference (CC) and body condition score (BCS) of 440 cattle from 29 breeding groups in Urut Sewu which included Mirit subdistrict, Ambal, Buluspesantren, Klirong, Petanahan, and Puring subdistrict. The study applied a survey method allocating two age groups: U1= 18 – 24 months and U2 = >24 – 36 months. The observed variables were BW, CC and BCS. The collected data were subject to an Independent sample test (t-test). The result showed a highly significant difference (P<0.01) between U1 and U2. The average BW, CC, and BCS of Kebumen “Peranakan Ongole” (PO) cattle in U1 were 306,04 ± 67,86 kg, 153,99 ± 11,74 cm and 3,18 ± 0,41, respectively, and in U2 were 368,00 ± 97,79 kg, 163,10 ± 14,38 cm and 3,48 ± 0,58, respectively. The body condition score of Kebumen PO cattle was higher than in the Indonesian National Standard (SNI); therefore, PO cattle had an improved grade as potential germplasm of indigenous cattle in Indonesia

Keywords
Peranakan Ongole (PO), Age, body weight (BW), chest circumference (CC), body condition score (BCS)

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/CERjN4vPTeAQ

Corresponding Author
Diana Indrasanti

Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman, Purwokerto, Indonesia

Abstract
This study aims to determine oocyst excretion and hematological profile in coccidiosis rabbits given a combination of herbal extract II. Hematological profiles observed were red blood cells (RBC), white blood cells WBC), hemoglobin (HGB), hematocrit (HCT), granulocytes, eosinophils, monocytes, lymphocytes, MCV (Mean Corpuscular Volume), MCH (Mean Corpuscular Hemoglobin) and MCHC (Mean Corpuscular Hemoglobin Concentration). This study used 40 rabbit coccidiosis material with ± 3 months age of ± 650 g weight, a combination of herbal extracts consisting of banana stem extract (BSE), papaya seeds (PSE) and garlic (GE), a set of tools and materials for rabbit maintenance and a set of hematological examination tools. The research method was carried out experimentally using a Completely Randomized Design (CRD). The analysis used variance analysis followed by Honest Real Difference (HRD). The combination of herbal extract II consists of BSE: 40 mg; PSE: 20 mg; GE: 40 mg. Rabbits were divided into 8 treatments with 5 replications, namely giving a combination of herbal extracts 0 mg (D0), 10 mg (D1), 20 mg (D2), 40 mg (D3), 80 (D4) mg, 100 mg (D5) and the comparison are used herbal extract I (consist of BSE: 33 mg; PSE: 2 mg; GE: 65 mg) as much as 100 mg (D6) and Aquaprime® (D7). Blood collection is carried out through the heart on the 14th day after treatment. The combination of herbal extract II had a very significant effect on oocyst excretion, but did not have a significant effect on all hematology parameters. Hence, a combination of herbal extracts can be used as an alternative to reduce the number of oocysts in rabbits coccidiosis

Keywords
Rabbit coccidiosis; Oocyst; Herbal extract

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/Fg7VQPrzkt6v